ESTIMATION OF ANTI-INFLAMMATORY ACTIVITY AS WELL AS APOPTOTIC ACTIVITY OF ETHANOLIC EXTRACTS OF CROCUS SATIVUS

  1. Arirudran1, P. Priyadharshini1, US Mahadeva Rao2*

1PG Department of Biochemistry, SRM Arts and Science College, Kanchipuram district, Tamilnadu, India.

2School of Basic Medical Sciences, Faculty of Medicine, Universiti Sultan Zainal Abidin, Kuala Terengganu, 20400 Malaysia.

DOI:  https://doi.org/10.22270/ujpr.v3i6.217  

ABSTRACT

Inflammation is a body reaction which embroils cellular and biochemical responses, which is not only symptom for shared diseases but also known to be an initial phase for certain serious Alzheimer’s, cancer, heart vascular diseases. In order to overcome these drawbacks, there is an urgent need for nutraceuticals with excellent anti-inflammatory response with minimum side effects. Aim: An attempt has been made to evaluate the anti-inflammatory activity along with gene expression analysis on ethanolic extracts of Crocus sativus (CSEE). Dried stigmas of C. sativus were analyzed for anti-inflammatory activity by macrophage scavenging assay. In this study, the phagocytic activity of the extract was tested on oxidative burst reduction of macrophages. RT-PCR was performed to analyze the anti-apoptotic gene expression during cell death, as a result of the compound treatment on cancer cells. The CSEE unveiled high phagocytic activity on the oxidative burst reduction, presenting intracellular killing and the enhancement of lysosomal enzyme activity, showing the active degranulation of macrophages. These findings suggest that C. sativus possessed excellent anti-inflammatory as well as apoptotic activities. Hence it was proposed that C. sativus could be exploited against oxidative stress, anti-inflammatory, cancer and ageing therapy to justify their use in traditional medicine as a nutraceutical.

Keywords: Anti-inflammatory, crocus sativus, macrophage, nutraceutical, oxidative stress.

INTRODUCTION

Inflammation is a physiological reaction which involves cellular and biochemical responses, which is not only symptom for common diseases but also known to be an early phase for some serious diseases such as alzheimer’s disease, cancer, heart vascular diseases etc1. Non-steroidal anti-inflammatory drugs like ketoprofen, ibuprofen, aceclofenac, algesia and pyresis are under current clinical usage for the treatment of inflammation2, but due to the decrease in production of prostaglandins in tissue3 and due to the direct contact of free carboxylic group with the gastric mucosa they were associated with major drawbacks of gastrointestinal disorders like dyspepsia, and gastric ulcers4,5. In order to overcome these drawbacks, there is an urgent need for nutraceuticals with excellent anti-inflammatory response and minimum side effects. The term “nutraceuticals” combines two words “nutrient” (a nourishing food component) and “pharmaceutical” (a medical drug). The name was coined in 1989 by Stephen DeFelice, founder and chairman of the Foundation for Innovation in Medicine, an American organization located in Cranford, New Jersey. The philosophy behind nutraceuticals is to focus on prevention, according to the saying by a Greek physician Hippocrates (known as the father of medicine) who said “let food be your medicine”. Their role in human nutrition is one of the most important areas of investigation, with wide-ranging implications for consumers, health-care providers, regulators, food producers and distributors. Nutraceuticals are increasingly being used as nutritional supplements in treatment of diseases. Due to the plant origin of these supplements they are considered safe for human consumption. However, the levels of the active substance consumed vary when taken as a whole food, as compared to a nutritional supplement6,7. Very few studies have reported on long-term effects of nutrition supplements in humans. Among the nutraceuticals, Crocus sativusis an important crop cultivated as the source of its spice for at least 3,500 years. Dried stigmas of saffron flowers compose the most expensive spice which has been valuable since ancient times for its odoriferous, coloring and its medicinal properties8. Saffron has been also used as a drug to treat various human health conditions such as coughs, stomach disorders, colic, insomnia, chronic uterine haemorrhage, femine disorder, scarlet fever, smallpox, colds, asthma and cardiovascular disorders9-11. Earlier reports say that extractive of saffron shows antitumor effect against different malignant cells12 and different tumors as well as cancers in ancient time13.The present study is focused to evaluate the anti-inflammatory activity along with apoptotic activity of ethanolic extracts of C. sativus (CSEE).

MATERIALS AND METHODS

Chemical

Nitrobluetetrazolium dye, Dimethysulfoxide, Ethanol and all other chemicals and solvents were purchased from Sigma Chemical Co, St. Louis, MO, USA.

Sample collection:

Fresh stigma of C. sativus samples were purchased commercially from Nilgiris. Sample was authenticated based on organoleptic, macroscopic examination (PARC/2012/1254) and certified by Dr. P. Jayaraman, Director “National institute of Herbal Science & Plant Anatomy Research Centre” (PARC), West Tambaram, Chennai, Tamilnadu, India.

Preparation of CSEE

The CSEE was prepared as described by the standard method14. Ten grams of C. sativus dried stigma was coarsely powdered and weighed. The dried powder was soaked with ethanol for 48hr with intermediate shaking separately. At the end of the extraction, it was passed through Whatman filter paper No.1 (Whatman Ltd., England). Then the filtrate was concentrated by distillation over boiling water bath and the last traces of solvent were removed under vacuum. The yield of the extract was calculated (1.0443g), stored in dry sterile container and used for further study.

Macrophage scavenging assay

Nitrobluetetrazolium dye reduction assay was carried out formacrophage scavenging assay15. Briefly, 20µl of the macrophage suspension and 40µl of Roswell park memorial institute medium (RPMI) were added in a flat bottom 96-well plate. Twenty micro liter of the solution containing the CSEE dissolved in 0.1% Dimethysulfoxide (DMSO) in phosphate buffer saline solution was added in each well at final extract concentrations of 10µg/ml, 100µg/ml, 500µg/ml and 1000µg/ml. The 0.1% DMSO in phosphate buffer alone used as a control. After incubation for 24hr at 37ºC in 5% CO2 humidified atmosphere, 20µl of the heated inactivated yeast (Saccharomyces cerevisiae) suspension (5×107 particles/ml) and 20µl of Nitrobluetetrazolium solution in phosphate buffer (1.5mg/ml) were added and the mixture was further incubated under the same conditions. After incubation for 60min, the adherent macrophages were rinsed vigorously with RPMI medium and washed for four times with 200ml methanol. After air-dried, 120µl of 2M KOH and 140µl of DMSO were added. The absorbance was measured at 570nm by a well reader (Biorad Plate reader) and the percentage of NBT reduction was calculated by the following equation.

The EC50 value represents the effective concentration required for 50% enhancement of oxidative burst reduction activity.

RT-PCR

RT-PCR was performed to analyze the gene expression during cell death, as a result of the compound treatment on cancer cells. Cells were harvested after treatment with active fraction. Total RNA was separated and cDNA was synthesized according to the manufacturer’s protocol (Sigma Aldrich, USA). Using this cDNA as template, PCR was performed with Tnf and GAPDH gene specific primers.

Total RNA isolation

Total RNA from cell lines was separated using ONE STEP-RNA solution (phenol and guanidine isothiocyanate). It is a ready to be used reagent for the isolation of total RNA from cells and tissues. The reagent, mono-phasic solution of phenol and guanidine isothiocyanate, represents an improvement to the single step RNA isolation method developed by Chomczynski and Sacchi16. In order to decrease the possibility of RNA degradation during the procedure, all glassware and plastic ware were treated by incubating them overnight in 0.01% DEPC water (RNase-free) to decrease or reduce the risk of RNA begin depredated by RNase17. After incubation, all of the materials used for isolation were autoclaved and dried in the oven. Approximately 5-10x106 cultured cells were taken to ensure for RNA isolation. Cells were pelleted by centrifugation at 1000rpm, 5minutes and 1ml of ONE STEP-RNA reagent was added. Cell lysis was performed by repeated pipetting. Homogenized samples were incubated at 15 to 30°C for 5min to allow the complete dissociation of nucleoprotein complexes; 0.2ml of chloroform per 1ml of ONE STEP-RNA reagent to the sample. Tubes were shaken vigorously by hand for 15sec and incubated at 15 to 30°C for about 2 to 3min and then the samples were centrifuged at 12,000 rpm for 15min at 2 to 8°C. The mixture separated into two phase, lower phenol-chloroform inter-phase of cloudy white and upper colorless aqueous phase. The RNA remains exclusively in 60% volume of upper aqueous phase of ONE STEP-RNA reagent used for homogenization. RNA was precipitated from the aqueous phase by mixing it with isopropyl alcohol. Samples were incubated at 15 to 30°C for 10min and centrifuged at 12,000rpm for 10min at 2 to 8°C. The RNA precipitate, often invisible before centrifugation, supernatant was removed and the gel-like RNA pellet at the bottom was washed once with 75% ethanol by centrifuging at 7,500 rpm for 5min at 2 to 8°C. RNA pellet was dried by vacuum-dry for 5 to 10min and finally dissolved in DEPC treated water and stored in -20°C.

cDNA preparation

After RNA isolation, RNA was immediately reverse transcribed with Easy Script Plus™ Reverse Transcriptase. For RT-PCR, 1-2µg of RNA was used corresponding to 1-10µl of total RNA isolate. RNA isolated from fresh tissue samples was reverse transcribed, where oligo-dT was used as a primer, into a 1.5ml eppendorf PCR tube, 1-2µg of RNA, 2µl of oligo-dT (stock was 10µM) was added and the total volume was made up to 12.5µl with DEPC treated water. The tube was incubated at 65ºC for 5min and chilled on ice. Then, 4µl of 5X reverse transcriptase buffer (final concentration 1X), 2µl of 2mMdNTP mix (final concentration 0.2mM) and 0.5µl of RNase inhibitor (40U/µl) were added in the indicated order. After incubating at 42ºC for 5min, 1µl of Easy Script Reverse Transcriptase (200 U/µl) was added. The reaction was carried out at 42ºC for 50min. Finally, the tube was heated up to 70ºC for 10min and chilled on ice. The samples were stored at -20ºC until further use.

PCR

The cDNA obtained was amplified by PCR. Gene specific PCR was used to amplify Tnf. A constitutively expressed gene, namely GAPDH was selected in order to assess the quality of PCR. The primers for the study were purchased from Eurofins Genomics India Pvt Ltd., Bangalore, India. Anti-apoptotic gene expressions were studied using primers intF and intR primers(Table 1, 2 and 3). Amplification was carried out in a 20μl volume containing 0.3µM of each primer (Eurofins, India), 0.2mM deoxy nucleotide triphosphates (dATP, dCTP, dGTP and dTTP) (Biotools, Spain), 100ng of template DNA sample and 1U of Prime Taq DNA polymerase (Genetbio, Korea). The reaction tubes were subjected for thermal cycling reactions consisted of an initial denaturation (3min at 94°C) followed by 32 cycles of denaturation (30sec at 94°C), annealing (1min at 49°C) and extension (1min 20sec at 72°C), with a final extension (7min at 72°C). The procedure was repeated for GAPDH gene. PCR products were visualized using 1.5% agarose gel stained with EtBr (20mg/ml). The molecular weight of the bands was estimated using 1Kb DNA Ladder as reference.

Agarose Gel Electrophoresis of PCR Products

In a total volume of 25ml, 1.5% agarose and 1X TAE buffer were prepared and poured onto a gel tray. The PCR product was mixed with the loading dye. The mixture was loaded to each well along with 1kb ladder as a reference. The gel was run at 50V for 90min and visualized.

Expression folds calculation

Expression ratio was derived by analyzing the gel photos in software - Image J (Java based image processing). Expression ratio was obtained using the formula:

RESULTS AND DISCUSSION

In this study, the phagocytic activity of the CSEE was tested on oxidative burst reduction of macrophages. The Figure 1 shows that CSEE enhanced the NBT reduction at 10, 100, 500 and 1000 µg/ml by 5% (p < 0.01), 35% (p < 0.01), 55% (p < 0.01) and 65% (p < 0.01) respectively. The higher reduction in NBT assay represented higher activity of the oxidase enzyme reflecting the stimulation of phagocytes in proportion to the foreign particles ingested15. CSEE exhibited high phagocytic activity on the oxidative burst reduction, presenting intracellular killing and the enhancement of lysosomal enzyme activity, showing the active degranulation of macrophages. The maximum phagocytic activity of the extract on the NBT dye reduction was found and the % of NBT dye reduction was found to be 1000µg of CSEE, with an EC50 value of 150mg/ml.

Crocins, Crocus glycosides, exhibited an anti-inflammatory effect in some models of inflammation18. Flavonoids such as rutin, quercetin, luteolin, hesperidin and bioflavonoid produced significant antinociceptive and anti-inflammatory activities19-21. Flavonoids, tannins, anthocyanins, alkaloids and saponins exhibited antinociceptive effects in chemical pain test as well as acute and chronic anti-inflammatory activity22-23. It was reported that tannins has an important role in antinociceptive and anti-inflammatory activities24. Phenolic compounds have been shown to possess antioxidant activity based on their (hydroxyl group) donation to free radicals. Moreover, phenolic compounds also possess a wide spectrum of biological activities such as antimutagenic, anticarcinogenic, anti-inflammation, anti-allergic, as well as the ability to modify gene expression25-32. The authors have had phytochemical study in CSEE and reported that C. sativus extract has a rich amount of secondary metabolites like carbohydrates, tannins, saponins, flavonoids, alkaloids, quinones, cardiac glycosides, phenols, coumarins, phyto steroids, anthroquinones33. The anti-apoptotic activity related gene expression study results were well aligned with other researcher’s findings with different extracts (Musa paradisiaca, Vernoniaamygdalina, Melastomamalabathricum, Persea americana, Monopterusalbus and Channastraitus extracts) as well as secondary metabolites  (syringin and scopoletin)34-40. Henceforth, these findings advocated that, the phagocytic mediated to macrophage-lymphocyte defense system may be due to the presence of some secondary metabolic active principle compounds present in the CSEE and it is responsible for intracellular killing more than degranulation. This property of C. sativus may be a safe and effective choice in the treatment of anti-inflammatory disorders. In future, studies should be carried out to pinpoint the mechanism of respective phytochemical both in an animal model and cell lines to exploit the medicinal potential of C. sativus. In the present study the plate 1 and 2displayed that the RT-PCR was made with Tnf and GAPDH gene specific primers to amplify. In the plate 1, Tnf gene was expressed in 1KB ladder of about 500bp was observed, in the photographic plate 2 and GAPDH gene was expressed in 1KB ladder of about 400bp.

In this model, CSEE caused the suppression and subsequent expression of mRNA for tumor necrosis factor, interleukin. It has been demonstrated that CSEE possesses anti-apoptotic effects on non-cancerous cells which incorporate out it into a model showing a possible mechanism for the anti-cancer effect of saffron by promoting apoptosis, inhibiting cell proliferation and blocking inflammation in carcinomas by Tnf expressions. Tumour necrosis factor Tnf is a cytokine that has a wide variety of functions. It can cause cytosis of certain tumor cell lines; it is involved in the induction of cachexia; it is a potent pyrogen, causing fever by direct action or by stimulation of interleukin-1 secretion; it can stimulate cell proliferation induced cell differentiation under certain conditions. These findings indicate that saffron provides an anticancer protective effect by promoting cell death apoptosis and inhibiting proliferation of cancerous cells and blocking inflammation.

CONCLUSION

In supposition, these preliminary findings indicated that C. sativus can be a potential source of natural immunostimulator as well as an antioxidant agent. In addition, CSEE (Saffron stigma and petal) exhibit antinociceptive, anti-inflammatory activity, along with potential free radical scavenger and act as an important tool in cancer prevention. Further studies are warranted to isolate the active constituent from C. sativus for herbal preparations against oxidative stress, inflammation, cancer, ageing etc, and justifying their use in traditional medicine.

ACKNOWLEDGMENT

The authors would like to thankful to Mrs. Florida Tilton and Staff members of Biozone research technologies Lab, Chennai, India for providing laboratory facilities and technical assistance.

CONFLICT OF INTEREST

No conflict of interest associated with this work.

REFERENCES

  1. Ingale N, Maddi V, Palkar M et al., “Synthesis and evaluation of anti-inflammatory and analgesic activity of 3-[(5-substituted-1,3,4-oxadiazol-2-yl-thio)acetyl]-2H-chromen-2-ones. Med Chem Res. 2012; 21(1): 16-26.
  2. Rigas B. The use of nitric oxide-donating nonsteroidal anti-inflammatory drugs in the chemoprevention of colorectal neoplasia. Current Opinion Gastr. 2007; 23(1): 55-59.
  3. Venerito M, Wex T, Malfertheiner P. Nonsteroidal anti-inflammatory drug-induced gastroduodenal bleeding: risk factors and prevention strategies. Pharmaceuticals. 2010; 3(7): 2225-2237.
  4. Lanas A, García-Rodríguez LA, Arroyo MT et al. Effect of antisecretory drugs and nitrates on the risk of ulcer bleeding associated with nonsteroidal anti-inflammatory drugs, antiplatelet agents, and anticoagulants. The American J Gastr. 2007; 102 (3): 507-515.
  5. Prakash S, Gupta BN, Moorthy NSH. Synthesis and physicochemical characterization of mutual prodrug of indomethacin. Trends in Applied Sci Res. 2007; 2 (2): 165-169.
  6. Egert S, Rimbach G. Which sources of flavonoids: complex diets or dietary supplements?. Advances in Nutrition. 2011; 2 (1); 8-14.
  7. Toxicological aspects of the use of phenolic compounds in disease prevention. Interdisciplinary Toxicol. 2011; 4(4): 173-183.
  8. Plessner O, Negbi M., Ziv M, Basker D. Effects of temperature on the flowering of the saffron crocus (Crocus sativus ): Induction of hysteranthy. Israel J Bot. 1989; 38: 1-7.
  9. Giaccio M. Components and features of saffron. Proceedings of the International Conference on Saffron, (ICS'90), Italy. 1990; 135-148.
  10. Winterhalter P, Straubinger M. Saffron-renewed interest in an ancient spice. Food Rev. Int. 2000; 16: 39-59.
  11. Abdullaev Crocus sativus against cancer. Arch Med Res. 2003; 34: 354-354.
  12. Abdulnabi AA, Emhemed AH, Hussein GD, Biacs PA. Determination of antioxidant vitamin in tomatoes. Food Chemistry. 1997; 60: 207-212.
  13. Hartwell JL.1982. Plants Used Against Cancer: A Survey. Quaterman Publications, Lawrence, CA. Himeno, H. and K. Sano. Synthesis of crocin, Picrocrocin and safranal by saffron stigma-like structures proliferated in vitro. Agric Biol Chem. 1987; 51: 2395-2400.
  14. Aqil F, Ahmad I. Antibacterial properties of traditionally used Indian medicinal plants. Methods Find Exp. Clinical Pharmacology. 2007; 29 (2): 79-92.
  15. Rainard PA. Colorimetric microassay for opsonins by reduction of NBT in phagocytosing bovine polymorphs. J Immun Meth. 1986; 90: 197-201.
  16. Chomczynski P, Sacchi N. Single-step method of RNA-isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Annual biochemistry. 1987; 162:156-9.
  17. Neurochemistry Research.1987: 12 (4).
  18. Ma S, Zhou S, Shu B, Zhou J. Pharmacological studies on Crocus glycosides I. Effects on anti-inflammatory and immune function. Zhongcaoyao. 1998; 29: 536-539.
  19. Bittar M, de Souza MM, Yunes RA, Lento R., DelleMonache F, Cechinel Filho V. Antinociceptive activity of I3, II8-binaringenin, a biflavonoid present in plants of the guttiferae. Planta Med. 2000; 66: 84-86.
  20. Galati EM, Monforte MT, Kirjavainen S, Forestieri AM, Trovato A, Tripodo MM. Biological effects of hesperidin, a citrus flavonoid. (Note I): anti-inflammatory and analgesic activity. Farmaco. 1994; 40: 709-712.
  21. Ramesh M, Rao YN, Rao AV, Prabhakar MC, Rao CS, Muralidhar N, Reddy BM. Antinociceptive and anti-inflammatory activity of a flavonoid isolated from Carallumaattenuata. J Ethnopharmacol. 1998; 62:63-66.
  22. Hosseinzadeh H, Khosravan V. Anticonvulsant effects of aqueous and ethanolic extracts of Crocus sativus stigmas in mice. Arch. Iran Med. 2002a; 5: 44-47.
  23. Hosseinzadeh H, Younesi HM. Antinociceptive and anti-inflammatory effects of Crocus sativus stigma and petal extracts. BMC. Pharmacol. 2002b; 2: 7.
  24. Starec M, Waitzov'a D, Elis J. Evaluation of the analgesic effect of RG-tannin using the "hot plate" and "tail flick" method in mice. Cesk Farm. 1988; 37:319-321.
  25. Marinova D, Ribarova F, Atanassova M. Total phenolics and total flavonoids in Bulgarian fruits and vegetables. J Univ Chem Technol Metall. 2005; 40: 255-260.
  26. Ibrahim MH, Hawa ZEJ. Carbon dioxide fertilization enhanced antioxidant compounds in Malaysian Kacip Fatimah (Labisiapumila Blume). Molecules. 2011; 16: 6068-6081.
  27. Ibrahim MH, Jaafar HZE. Enhancement of leaf gas exchange and primary metabolites, up-regulate the production of secondary metabolites of Labisia Pumila Blume seedlings under carbon dioxide enrichment. Molecules. 2011; (16): 3761-3777.
  28. Ibrahim MH, Jaafar HZE. Photosynthetic capacity, photochemical efficiency and chlorophyll content of three varieties of Labisiapumila Exposed to open field and greenhouse growing conditions. Acta Physiol. Plant. 2011; (33): 2179-2185.
  29. Ibrahim MH, Jaafar HZE. The influence of carbohydrate, protein and phenylanine ammonia lyase on up-regulation of production of secondary metabolites (total phenolics and flavonoid) in Labisiapumila (Blume) Fern-Vill (Kacip Fatimah) under high CO2 and different nitrogen levels. Molecules. 2011; (16): 4172-4190.
  30. Ibrahim MH, Jaafar HZE. The relationship of nitrogen and C/N on secondary metabolites and antioxidant activities in three varieties of Malaysia Kacip Fatimah (Labisiapumila Blume). Molecules. 2011; (16): 5514-5526.
  31. Ibrahim MH, Jaafar HZE, Haniff MH, Raffi MY. Changes in growth and photosynthetic patterns of oil palm seedling exposed to short term CO2 enrichment in a closed top chamber. Acta Physiol Plant. 2010; (32): 305-313.
  32. Ibrahim MH, Jaafar HZE, Rahmat A, Zaharah AR. Effects of nitrogen fertilization on synthesis of primary and secondary metabolites in three varieties of Kacip Fatimah (LabisiapumilaBlume). Int J Mol Sci. 2011; (12): 5238-5254.
  33. Arirudran B, Thenmozhi A, Priyadharshini P. Evaluation of preliminary phytochemicals and antioxidant efficacy of Crocus sativus Int J Pharm Res Dev. 2014; 5(12): 1-8.
  34. Mahadeva Rao US, Ahmad BA, Mohd KS. In vitro nitric oxide scavenging and anti inflammatory activities of different solvent extracts of various parts of Musa paradisiaca. Malaysian J Anal Sci. 2016; 20(5): 1191 – 1202.
  35. USMR, Zin T. The effect of Syringin on the expression of TNF-α, iNOS, ICAM-1 and its’ mRNA in the heart, brain and kidneys of spontaneously hypertensive rats. Der Pharmacia Lettre. 2016; 8(3):53-61.
  36. Khalili Rohin MA, Norhaslinda R, Jumli MN, Abd Hadi N, Hussin N, Zahary MN, Syed Ahmad Tajudin Tuan Johari, Mahadeva Rao US, Ahmad Zubaidi A. Latif. Screening Of Bismillah Leaf (Vernonia Amygdalina) extraction for antiproliferative activies in human glioblastoma brain cancer cell lines. Research J Pharm, Biol Chemical Sciences. 2016; 7(2):1084-89.
  37. Sundaram SC, MahadevaRao US, Simbak N. Regulatory efficacy of scopoletin, a biocoumarin on aortic oxidolipidemic stress through antioxidant potency as well as suppression of mrna expression of inos gene in hypercholesterolemic rats. Der Pharmacia Lettre. 2015; 7 (10):57-67
  38. Danladi S, Wan-Azemin A, Sani YN, Mohd KS, USMR, Mansor SM, Dharmaraj S. Phytochemical screening, antioxidant potential and cytotoxic activity of melastomamala bathricum linn from different locations. Int J Pharm Pharm Sci. 2015; 7(7): 408-413.
  39. Atif AB, Zahri MK, Esa AR, Zilfalil BA, USM Rao, S Nordin. Comparative analysis of the antibacterial, antifungal, antiproliferative and cyclic response element (CRE) induced expression of downstream luc gene activities of Monopterusalbus and Channastraitus J Appl Pharm Sci. 2015; 5 (1):42-47.
  40. USMR Kumar Ponnusamy, Naidu JR, Sundaram CS. Modulatory influence of avocado on renal oxidolipidemic stress and mrna expression of nos in renal artery studied in nephropathy induced rats. Intl Med J (Japan) 2014; 21(3):353–58.

 

 

Table 1: Sequence of the primer used in the RT-PCR

Tnf F

5’ ATGATGGATCTTGAGAGTCAG 3’

Tnf R

5’ TCATAAAGCAAACACCCCAAAGAA 3’

GAPDH Forward

5` TCCCATCACCATCTTCCA 3`

GAPDH Reverse

5` CATCACGCCACAGTTTCC 3`

 

Table 2: PCR reaction setup for GAPDH and Tnf genes

­

Stock Concentration

Final Concentration

Final Volume (for 20µl)

Mili Q Water

-

-

11.4µl

Taq Buffer (with MgCl2)

10X

1X

2µl

dNTPs

2mM

0.2mM

2µl

MgCl2

25mM

2.5mM

2µl

Primer-Forward

3nM

0.3µM

0.2µl

Primer-Reverse

3M

0.3µM

0.2µl

Template cDNA

-

10% of the reaction

2µl

Taq Polymerase

5U/µl

1 U

0.2µl

  


Table 3: PCR reaction conditions for GAPDH and Tnf genes

 

Tnf

GAPDH

Initial denaturation

94?C for 2min

94?C for 2min

Denaturation

94?C for 30sec

94?C for 30sec

Annealing

56?C for 1min

53?C for 1min

Extension

72?C for 1min 20sec

72?C for 1min 20sec

Final extension

72?C for 7min

72?C for 7min

Hold

4?C

4?C

Total number of cycles

32

32

 

 

Figure 1: Anti-inflammatory activity for Crocus sativus ethanolic extract.

    

           

     Figure 2: Plate 1: Expression of Tnf gene, Plate 2: Expression of GAPDH gene